Search alternatives:
decrease decrease » decrease release (Expand search), disease decreases (Expand search), decreases disease (Expand search)
using polymerase » time polymerase (Expand search), rna polymerase (Expand search), dna polymerase (Expand search)
decrease using » decrease during (Expand search), decrease owing (Expand search), decreases during (Expand search)
decrease after » increase after (Expand search), disease after (Expand search)
decrease the » decreases the (Expand search), decrease in (Expand search)
the decrease » to decrease (Expand search), and decrease (Expand search)
decrease of » decrease in (Expand search)
of decrease » or decrease (Expand search), not decrease (Expand search), to decrease (Expand search)
Showing 1 - 20 results of 65 for search '(( decrease of decrease using polymerase ) OR ( decrease the decrease decrease after ))~', query time: 1.53s Refine Results
3
Published 2014
“... of Hsp70 and Bax, decrease the expression of mutant p53, and had little effect on Bcl-2. RT-PCR indicated...”
Access document
Article
4
Published 2024
“... a decrease in the effect over time after completion of vaccination, something that resembles the pattern...”
Access document
Master thesis
5
Published 2018
Subjects: “...Polymerase chain reaction...”
Access document
Doctoral thesis
7
Published 2015
“..., GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting...”
Access document
Article
8
Published 2008
“... conducted using the differential display (DD) and real time polymerase chain reaction (PCR) techniques...”
Access document
Article
11
Published 2013
“...Aim: To quantify bacterial equivalents before and after chemomechanical preparation using 3% sodium...”
Access document
Article
13
Published 2016
“..., higher recovery was achieved when using the two stepwise gradients. The purified nucleic acids were then...”
Access document
Master thesis
17
Published 2016
“... of oocytes. Preliminary data in humans have suggested that ovarian CNP levels may decrease after the...”
Access document
Master thesis
18
Published 2024
“... Repetitive Intergenic Consensus Polymerase Chain Reaction (ERICPCR). Adicionalmente, as populações em estudo...”
Access document
Master thesis
Export CSV Export RIS