Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Bibliographic Details
Main Author: Dang,N.N.
Publication Date: 2015
Other Authors: Pang,S.G., Song,H.Y., An,L.G., Ma,X.L.
Format: Article
Language: eng
Source: Brazilian Journal of Medical and Biological Research
Download full: http://old.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2015000100039
Summary: The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
id ABDC-1_213b39d8ca82163fef9350253f90dcd7
oai_identifier_str oai:scielo:S0100-879X2015000100039
network_acronym_str ABDC-1
network_name_str Brazilian Journal of Medical and Biological Research
repository_id_str
spelling Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune responseAtopic dermatitisT helper 2 cytokinesFilaggrin silencingPathogenesisThe objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.Associação Brasileira de Divulgação Científica2015-01-01info:eu-repo/semantics/articleinfo:eu-repo/semantics/publishedVersiontext/htmlhttp://old.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2015000100039Brazilian Journal of Medical and Biological Research v.48 n.1 2015reponame:Brazilian Journal of Medical and Biological Researchinstname:Associação Brasileira de Divulgação Científica (ABDC)instacron:ABDC10.1590/1414-431x20144047info:eu-repo/semantics/openAccessDang,N.N.Pang,S.G.Song,H.Y.An,L.G.Ma,X.L.eng2019-03-19T00:00:00Zoai:scielo:S0100-879X2015000100039Revistahttps://www.bjournal.org/https://old.scielo.br/oai/scielo-oai.phpbjournal@terra.com.br||bjournal@terra.com.br1414-431X0100-879Xopendoar:2019-03-19T00:00Brazilian Journal of Medical and Biological Research - Associação Brasileira de Divulgação Científica (ABDC)false
dc.title.none.fl_str_mv Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
title Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
spellingShingle Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
Dang,N.N.
Atopic dermatitis
T helper 2 cytokines
Filaggrin silencing
Pathogenesis
title_short Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
title_full Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
title_fullStr Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
title_full_unstemmed Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
title_sort Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
author Dang,N.N.
author_facet Dang,N.N.
Pang,S.G.
Song,H.Y.
An,L.G.
Ma,X.L.
author_role author
author2 Pang,S.G.
Song,H.Y.
An,L.G.
Ma,X.L.
author2_role author
author
author
author
dc.contributor.author.fl_str_mv Dang,N.N.
Pang,S.G.
Song,H.Y.
An,L.G.
Ma,X.L.
dc.subject.por.fl_str_mv Atopic dermatitis
T helper 2 cytokines
Filaggrin silencing
Pathogenesis
topic Atopic dermatitis
T helper 2 cytokines
Filaggrin silencing
Pathogenesis
description The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
publishDate 2015
dc.date.none.fl_str_mv 2015-01-01
dc.type.driver.fl_str_mv info:eu-repo/semantics/article
dc.type.status.fl_str_mv info:eu-repo/semantics/publishedVersion
format article
status_str publishedVersion
dc.identifier.uri.fl_str_mv http://old.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2015000100039
url http://old.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2015000100039
dc.language.iso.fl_str_mv eng
language eng
dc.relation.none.fl_str_mv 10.1590/1414-431x20144047
dc.rights.driver.fl_str_mv info:eu-repo/semantics/openAccess
eu_rights_str_mv openAccess
dc.format.none.fl_str_mv text/html
dc.publisher.none.fl_str_mv Associação Brasileira de Divulgação Científica
publisher.none.fl_str_mv Associação Brasileira de Divulgação Científica
dc.source.none.fl_str_mv Brazilian Journal of Medical and Biological Research v.48 n.1 2015
reponame:Brazilian Journal of Medical and Biological Research
instname:Associação Brasileira de Divulgação Científica (ABDC)
instacron:ABDC
instname_str Associação Brasileira de Divulgação Científica (ABDC)
instacron_str ABDC
institution ABDC
reponame_str Brazilian Journal of Medical and Biological Research
collection Brazilian Journal of Medical and Biological Research
repository.name.fl_str_mv Brazilian Journal of Medical and Biological Research - Associação Brasileira de Divulgação Científica (ABDC)
repository.mail.fl_str_mv bjournal@terra.com.br||bjournal@terra.com.br
_version_ 1754302943711985664