Search alternatives:
decrease decrease » decrease release (Expand search), disease decreases (Expand search), decreases disease (Expand search)
decrease after » increase after (Expand search), disease after (Expand search)
il polymerase » in polymerase (Expand search), via polymerase (Expand search), by polymerase (Expand search)
decrease and » decreases and (Expand search), decrease in (Expand search), decrease of (Expand search)
and decrease » and decreases (Expand search), and decreased (Expand search), and increase (Expand search)
decrease il » decreased il (Expand search), decrease in (Expand search), decrease hiv (Expand search)
Showing 1 - 20 results of 25 for search '(( decrease and decrease il polymerase ) OR ( decrease AND decrease decrease after ))~', query time: 1.09s Refine Results
3
Published 2015
“..., GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting...”
Access document
Article
6
Published 2018
“...) and, after 24 hours, were treated with different concentrations of the barbatimão bark extract (0.24...”
Access document
Master thesis
8
Published 2022
“...). First, we started with the selection of the RRMS patients and collected blood from each one after...”
Access document
15
Published 2017
“... other hand, stimulation of PAR-2 promoted decreases in the expression of MMP2 and MMP13. CONCLUSION. The...”
Access document (1)
Access document (2)
Master thesis
18
Published 2020
“...1a, Epas1 and Hif3a). Rela estava sobre-regulado após 21 dias de HCI e o Nfkb2 após 60 dias, ambos...”
Access document
Export CSV Export RIS